Skip to main content

Advertisement

Table 4 Oligonucleotide probes that were used in the microarray for diagnosis of avian infections

From: New oligonucleotide microarray for rapid diagnosis of avian viral diseases

Probes Oligonucleotides sequence (5` → 3`) Length, nucleotides Virus Position in genome Gene
IBDV-VP2 AGGCACAGGCTGCTTCAGGAACTGCTCGAGCCGCGTCAGGAAAAGCAAGRGCTGCCTCAGGCCGCA 66 IBDV 1581–1640 VP2 (segment A)
IBV-S1 TTTCTGGTGGTAAATTAGTAGGTATTCTYACTTCACGTAATG 42 IBV 21,812–21,853 S1
AIV Flu-NP ACGAAAAGGCAACGAACCCGATCGTGCCTTCCTTTGACATGA 42 AIV 1403–1444 NP
AIV Flu-M2 CCTATCAGAAACGAATGGGGGTGCAGATGCAACGATTCAAGTGA 44 AIV 716–759 M2
NDV-NP AACAGGCCGGGGTCCTCACTGGGCTCAGCGACGAAGGTCCCCGAGCCC 48 NDV 1353–1400 NP