Skip to main content

Table 1 Primer sequences, annealing temperatures and amplicon lengths, obtained in nested PCR assays for SNPs in the TLR genes

From: Toll-like receptors genes polymorphisms and the occurrence of HCMV infection among pregnant women

Gene GenBank Accession No.a SNPb name Primer sequences (5’-3’) Annealing temperature [oC] Amplicon length (bps) c
TLR2 NC_000004.12 2258 G > A (rs5743708) External For: CGGAATGTCACAGGACAGC
Rev: GGACTTTATCGCAGCTCTCAG
52 605
Internal For: GCCTACTGGGTGGAGAACCT
Rev: GGCCACTCCAGGTAGGTCTT
59 340
TLR4 NG_011475 896 A > G External For: AAAACTTGTATTCAAGGTCTGGC 52 355
(rs4986790) Rev: TGTTGGAAGTGAAAGTAAGCCT
Internal For: AGCATACTTAGACTACTACCTCCATG 61 188
Rev: AGAAGATTTGAGTTTCAATGTGGG
1196 C > T External For: AGTTGATCTACCAAGCCTTGAGT 52 510
(rs4986791) Rev: GGAAACGTATCCAATGAAAAGA
Internal For: GGTTGCTGTTCTCAAAGTGATTTTGGGAGAA 59 407
Rev: ACCTGAAGACTGGAGAGTGAGTTAAATGCT
TLR9 EU170539 2848 G > A External For: GTCAATGGCTCCCAGTTCC 52 292
(rs352140) Rev: CATTGCCGCTGAAGTCCA
Internal For: AAGCTGGACCTCTACCACGA 59 177
Rev: TTGGCTGTGGATGTTGTT
  1. a No., number
  2. b SNP, single nucleotide polymorphism
  3. c bps, base pairs