Skip to main content

Table 1 Oligonucleotides used in this study

From: A novel benzo-heterocyclic amine derivative N30 inhibits influenza virus replication by depression of Inosine-5’-Monophospate Dehydrogenase activity

Oligonucleotide Sequence
5’ M2 (influenza) GACCRATCCTGTCACCTCTGAC
3’ M2 (influenza) GGGCATTYTGGACAAAKCGTCTACG
5’β-actin (Monkey) TGACGGGGTCACCCACACTGTGCCCATCTA
3’ β-actin (Monkey) CTAGAAGCATTTGCGGTGGACGATG
5’ VP1 (CVB3) TGCTCCGCAGTTAGGATTAGC
3’ VP1 (CVB3) ACATGGTGCGAAGAGTCTATTGAG
5’ M2 (RSV) GTTGCCATGAGCAAACTCCT
3’ M2 (RSV) ACGTCTGCTGGCAATCTTTT
5’ N (CoV-229E) CGCAAGAATTCAGAACCAGAG
3’ N (CoV-229E) GGCAGTCAGGTTCTTCAACAA
5’ GAPDH (Homo) GGTGGTCTCCTCTGACTTCAACA
3’ GAPDH (Homo) GTTGCTGTAGCCAAATTCGTTGT