Skip to main content

Table 3 Primers used for virus RT-PCR screening and virus quantification

From: Detection and genome characterization of four novel bat hepadnaviruses and a hepevirus in China

Primer Sequence (5′-3′)a Polarity Targeted virus Reference
HAV-3D-F1 CYTATHTRAARGATGAGCTKAGA + Hepatovirus This study
HAV-3D-F2 ACRTCATCICCRTARCAIAGRA +
HAV-3D-R1 RTCIAARACWAGRGCNATYG -
HAV-3D-R2 TACCWAATCATRAATGGACT -
HBV-pol-F1 TAGACTSGTGGTGGACTTCTC + Hepadnavirus This study
HBV-pol-F2 AGTRAAYTGAGCCAGGAGAAAC +
HBV-pol-R1 TGCCATCTTCTTGTTGGTTC -
HBV-pol-R1 CATATAASTRAAAGCCAYACAG -
BHV-1-F1 GTAGCGGAGAAGATGTATCTGGG + Hepacivirus [11]
BHV-1-R1 GCCTTAGCCTTGAGAAAGCAGGTGAT +
BHV-1-F2 GAGAAGATGTATCTGGGGGACGT +
BHV-1-R2 AGAAAGCAGGTGATGGTATTGCC +
BHV-2-F1 CCAAARGTWGTBAAGGCTGTGCT -
BHV-2-R1 ACTTTGAKCCASGCAGTKARACAGTT -
BHV-2-F2 GCTGTGCTSAAGGAMGAGTACGGCT +
BHV-2-R2 CCASGCAGTKARACAGTTACTRGAG -
DE-F4228 ACYTTYTGTGCYYTITTTGGTCCITGGTT + Hepevirus [7]
DE-R4598 GCCATGTTCCAGAYGGTGTTCCA -
DE-R4565 CCGGGTTCRCCIGAGTGTTTCTTCCA -
BtHEV-qF ATGTCCGTGTTCAGGTTCC + Bat hepevirus This study
BtHEV-qR GCCAACCCTCATTTGCAAC -  
BtHBV-qF TGTTGGTTCTCCTGGATTGGAG + Bat hepadnaviruses This study
BtHBV-qR TGAAGGAATGGGCCAGCAGGTG -  
  1. R: G/A; Y: C/T; S: G/C; W: A/T; M: A/C; K: G/T; H: A/C/T; N: A/T/C/G; I: inosine