Skip to main content

Table 1 Primers used in this study

From: Subcellular localization and interactions of Infectious Salmon Anemia Virus (ISAV) M1 and NEP as well as host Hsc70

Plasmid Primer Sequences
pEGFP-M1 pEGFP-M1-F CCGCTCGAGATGAACGAATCACAATGGATACAA
  pEGFP-M1-R CGCGGATCCCGCTTCAGGTACCCCAGAAGCAC
pDsRed2-NEP pDsRed2-NEP-F CCGCTCGAGATGGATTTCACCAAAGTGTA
  pDsRed2-NEP-R CCGGAATTCGGTTCTCATTACAAATGAATT
pEYFP-Hsc70 pEYFP-Hsc70-F CCGCTCGAGATGTCTAAGGGACCAGCAGTTG
  pEYFP-Hsc70-R CGCGGATCCCGATCAACCTCCTCGATGGTGGGA