vsiRNA No.a) | ID of predicted target gene | Expectation score b) | Target Accessibility (UPE) b) | Alignment | Inhibition manner | Putative function of rice target gene |
---|---|---|---|---|---|---|
vsiRS1_1 | LOC_Os08g29710.1 | 3.0 | 14.152 | miRNA 20 GCGUCUCACAUAGAGCUAAU 1 .::::: :::::::.:::: Target 1652 UGCAGAUUGUAUCUUGAUUU 1671 | Cleavage | galactosyltransferase family protein |
 | LOC_Os06g39650.1 | 3.0 | 19.7 | miRNA 20 GCGUCUCACAUAGAGCUAAU 1 .::::.::::: ::.::::. Target 1557 UGCAGGGUGUAGCUUGAUUG 1576 | Translation | pentatricopeptide |
vsiRS2_1 | LOC_Os02g07310.1 | 2.5 | 20.512 | miRNA 21 UCACAAUAGUAUAAGAUACCU 1 .:: :::::::.::::.:::. Target 2336 GGUAUUAUCAUGUUCUGUGGG 2356 | Cleavage | AGO17 |
vsiRS3_1 | LOC_Os09g25330.1 | 3.0 | 7.741 | miRNA 22 CUAAGAAGUUAA-GACGCAGAUU 1 : :::::.:::: ::::::.::: Target 158 GUUUCUUUAAUUGCUGCGUUUAA 180 | Translation | Bric-a-Brac, Tramtrack, Broad Complex BTB domain with non-phototropic hypocotyl 3 NPH3 domain, BTBN19 |
vsiRS4_2 | LOC_Os01g63710.2 | 3.0 | 11.886 | miRNA 20 UGUCAAACGUAACAGAGCAU 1 :::::::::::::: :: :: Target 1668 ACAGUUUGCAUUGUAUCUUA 1687 | Cleavage | Putative DNA replication initiation protein, CDC6 |
 | LOC_Os03g51270.1 | 3.0 | 14.253 | miRNA 20 UGUCAAACGUAACAGAGCAU 1 :::: :: :::: ::::::: Target 1029 ACAGCUUACAUUUUCUCGUA 1048 | Cleavage | F-box domain containing protein, OsFBX108 |
vsiRS5_1 | LOC_Os03g36790.2 | 3.0 | 21.375 | miRNA 20 GUCUUAACUCAGUGCUCACA 1 ::::::: :::..:::::: Target 204 CAGAAUUCAGUUGCGAGUGC 223 | Cleavage | tobamovirus multiplication protein |
vsiRS5_3 | LOC_Os07g35750.1 | 2.5 | 18.456 | miRNA 20 CACAACAGACGAACAAGCAC 1 ::::::: ::::::::.::: Target 3702 GUGUUGU-UGCUUGUUUGUG 3720 | Cleavage | DUF26 kinases homologous to DUF26 containing loci, TKL_IRAK_DUF26-ld.3 |
vsiRS6_1 | LOC_Os07g36280.1 | 2.5 | 16.42 | miRNA 22 UUGCUAGUGA-AACAAGAGAGUU 1 :: ::::::: :::::.:::::: Target 1053 AAAGAUCACUGUUGUUUUCUCAA 1075 | Cleavage | F-box domain containing protein, OsFBX241 |
 | LOC_Os05g50890.3 | 3.0 | 23.237 | miRNA 22 UUGCUAGUGAAACAAGAGAGUU 1 ..::.::.:::: :::::::.. Target 319 GGCGGUCGCUUUCUUCUCUCGG 340 | Translation | Probable indole-3-acetic acid-amido synthetase, OsGH3.5 |
vsiRS7_1 | LOC_Os02g54500.1 | 2.5 | 14.148 | miRNA 20 AGGAUGUCUUACAAUAAGUU 1 :: ::::::::::::::: : Target 3812 UCAUACAGAAUGUUAUUCUA 3831 | Cleavage | WD40-like, putative, expressed |
 | LOC_Os08g12780.1 | 3 | 17.599 | miRNA 21 AAGGAUGUCUUACAAUAAGUU 1 :::::.:::.: :::::::: Target 1935 UUCCUGCAGGAAAUUAUUCAA 1955 | Translation | chloroplast envelope membrane protein |
vsiRS8_1 | LOC_Os06g25560.1 | 2.5 | 13.472 | miRNA 20 CAGCUACAUCUAAGAUCACU 1 :.::::: ::::::::::: Target 454 CUUGAUGUUGAUUCUAGUGA 473 | Cleavage | retrotransposon protein |
 | LOC_Os04g11830.1 | 3.0 | 16.405 | miRNA 20 CAGCUACAUCUAAGAUCACU 1 :: :::::.:: :.:::::: Target 1708 GUGGAUGUGGAAUUUAGUGA 1727 | Translation | TCP family transcription factor |
vsiRS8_2 | LOC_Os12g40279.2 | 2.5 | 17.285 | miRNA 20 AGGAUGAGCACGGUAACGCU 1 ::.::::: :::.::::::. Target 3774 UCUUACUCUUGCUAUUGCGG 3793 | Cleavage | protein kinase domain containing protein |
vsiRS9_3 | LOC_Os06g20050.1 | 3.0 | 18.094 | miRNA 20 CGGUUCAGGUUAACUAGACA 1 ::::::.:::::::: ::: Target 2505 UCCAAGUUCAAUUGAUAUGU 2524 | Cleavage | leucine-rich repeat receptor protein kinase EXS precursor |
vsiRS9_3 | LOC_Os05g07820.1 | 3.0 | 17.222 | miRNA 20 CGGUUCAGGUUAACUAGACA 1 :.:.:::::: ::::::::: Target 586 GUCGAGUCCA-UUGAUCUGU 604 | Translation | NBS type disease resistance protein |
vsiRS10_1 | LOC_Os08g40170.2 | 3.0 | 19.095 | miRNA 21 UCGCGGGCUAGAAUAGGUAUU 1 ::.:.:.::::::.:::::.. Target 723 AGUGUCUGAUCUUGUCCAUGG 743 | Cleavage | cyclin-dependent kinase B2-1 |