Skip to main content

Table 1 RPA primers and probes designed in this study

From: Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus

Name Sequence (5′–3′) Genome location(X74443)
PPRV-RPA Fe1 N GAAGAGTTCAATATGTTGTTAGCCTCCAT 588–616
PPRV-RPA Fe2 N CCAAGGCGGTTACGGCACCGGATACGGCAGCTGAC 643–677
PPRV-RPA Fe3 N TTACGGCACCGGATACGGCAGCTGACTCAGAACTG 652–686
PPRV-RPA Re1 N TTTGTCAAGGCGAAATTCCCCAATCACTCTCC 715–746
PPRV-RPA Re2 N ACTGCGTCCAGCCACCCTTTGTCAAGGCGAAATTC 729–763
PPRV-RPA Re3 N ACTGCGTCCAGCCACCCTTTGTCAAGGCGAAA 732–763
PPRV-RPA Pe GATACGGCAGCTGACTCAGAACTGAGAAGG (FAM-dT)G(THF)G(BHQ1-dT)TAAATACACACAACA - C3 space 663–712
PPRV-RPA Fn1 N GAAGAGTTCAATATGTTGTTAGCCTCCAT 588–616
PPRV-RPA Fn2 N CCAAGGCGGTTACGGCACCGGATACGGCAGCTGAC 643–677
PPRV-RPA Fn3 N TTACGGCACCGGATACGGCAGCTGACTCAGAACTG 652–686
PPRV-RPA Rn1 N Biotin-TTTGTCAAGGCGAAATTCCCCAATCACTCTCC 715–746
PPRV-RPA Rn2 N Biotin-ACTGCGTCCAGCCACCCTTTGTCAAGGCGAAATTC 729–763
PPRV-RPA Rn3 N Biotin-ACTGCGTCCAGCCACCCTTTGTCAAGGCGAAA 732–763
PPRV-RPA Pn FAM-TACGGCAGCTGACTCAGAACTGAGAAGGTG 663–712
  -THF-GTTAAATACACACAA-C3 space  
  1. PPRV-RPA F and R, RPA primer; PPRV-RPA P, RPA Exo probe; BHQ1-dT, thymidine nucleotide carrying Black Hole Quencher 1; THF, tetrahydrofuran spacer; FAM-dT, thymidine nucleotide carrying fluorescein; C3 space, block elongation; “F”, “R”, “N”, “P”, “e” and “n” were defined as forward primer, reverse primer, nucleoprotein, probe, RPA exo kit and RPA nfo kit, respectively
\