Skip to main content

Table 3 Primers and probes used for the microarray

From: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus

Primer/Probe Length (bp) Sequence (5’ → 3’) Specificity
Primer name    
 Pr-dTS-f 20 Biotin ATGTMTAAGGYHAAGHTYAC TSWV serogroup
 Pr-dTS-r 26 Biotin GAAGCWATVAGAGGNADRCTWCCTCC
Probe name    
 Pb-AN 40 T20 ATGGACTTCCTTTGAATGAT ANSV
 Pb-CS 40 T20 ACGGGCTTAGCTTGAATGAT CSNV
 Pb-GR 40 T20 ACGGGCTGCCTCTGGCAGAT GRSV
 Pb-IN 40 T20 ATGGTCTTGCAACCACAGAT INSV
 Pb-TS 40 T20 ATGGATTACCTCTCGATGAT TSWV