Skip to main content

Table 2 The primer pairs used for cloning of N genes of tospoviruses

From: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus

Virus Primer name Sequence (5’ → 3’)
ANSV ANSV-Sph-Nde-N GGCATGCGGCATATGTCTAAGGCTAAGTTGACAAGGGAA
ANSV-Kpn-Xho-Nc GCTCGAGTTAGGTACCAGCAACACCTGAAATTTTGGATTC
CSNV CSN152Nco GCCATGGCTAAAGTTAAGCTTACAAAGG
CSN932cXho GCTCGAGAACAAGATCTTTAGGAATAAG
GRSV GR-Nc-N-2122 GCCATGGCTAAGGTCAAGCTCACA
GR-Xh-N-2895c GCTCGAGTGCAACAACAGCAATCTT
INSV IN2843cS GGGCATGCATGAACAAAGCAAAGATTACCAAG
IN2058K AAGGTACCAATAGAATCATTTTTCCCAAAATC
TCSV TC-Nc-N-f GCCATGGCTAAGGTCAAGCTCACC
TC-Xh-N-c GCTCGAGTGCAACACCTGAAATTTT
TSWV TN1990Xho GCTCGAGAGCAAGTTCTGCGAGTTTTGC
TN2763Ncoc GCCATGGCTAAGGTTAAGCTCACTAAG