Skip to main content

Advertisement

Table 3 CRISPR spacer regions corresponding to the genome sequence of Shbh1 and Mgbh1 in currently available bacterial genomes

From: Three novel bacteriophages isolated from the East African Rift Valley soda lakes

Phage Bacterial strain CRISPR spacer sequence CRISPR repeat unit sequence Location on phage
Mgbh1 B. halodurans C-125 CAAAGTGATCGGATCATTCGTTTAATCCCTCCCCTT GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 47980–48015
TCGAAAGTTTCGAGGAGTCTAACGGAGCGGAAGA GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 16247–16280
CTAACTGCAACGTTATATACGCGGGCTGTCTTGA GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 21267–21296
GTTGCG T ACCGCTCCTTGCGGCGACGTGTCGGGC GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 5105–5138
ATTATCGTTAGGGTAGGGGTTACTAT C G T AGATGAC GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 24974–25007
GTGCGGTAGATGATCCA G GACTTT C GATCGCCGTAATT GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 35921–35956
CGCCCAC T TTACGAATAACAGCAAGA G ACGTGCATAA GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 48859–48893
CCTACCGCG C CGCCAC T GTCGTTAAA G TCCTCTAGCGTC GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 27504–27539
GGATTTTACGAG A ACA G TGGAGCGATATATAAA C CGCG GTCGCACTCTACATGAGTGCGTGGATTGAAAT 3543–3577
Shbh1 B. halodurans C-125 TCTTAAA G TCTTTTATC T AATTGCTCTCTTGTAACA G GTCGCACTCTACACGAGTGCGTGGATTGAAAT 34484–34516
G A AAGTATGAC T AAGTTTGTAGGG T C A TTGAAAATTCATG GTCGCACTCTTCATGGGTGCGTGGATTGAAAT 25969–26003
  1. Subscript sequence corresponds to phage DNA sequence while superscript corresponds to the sequence of the bacterium