Skip to main content

Table 1 Primers used in the PCRs

From: Molecular epidemiology of hydropericardium syndrome outbreak-associated serotype 4 fowl adenovirus isolates in central China

Target genes Primers Expected product
Fragment I F: GCAGCGTGGTCTTGAAGATGGTTC 632 bp
R: CGCATTCAAGCCCGTTCGATTC
Fragment A F: CGTCTAGGTTCGCACCGCCATGGC 1501 bp
R: CATCTGGTCGATGGACCAACGCGCACC
Fragment B F: CATCGACCAGATGGACAACGTCAACCCCTTCAAC 1345 bp
R: TTACACGGCGTTGCCTGTGGCG
  1. All samples were confirmed to be FAdV-4 positive by PCR amplifying a 632-bp fragment (Named fragment I) of the polymerase gene. The hexon gene of FAdV-4 was divided into two fragments (Named fragment A and B) because of its long length in this study. Primers used for amplifying fragments I, A and B were designed according to the polymerase genes and hexon genes of FAdV-4 strain MX-SHP95 (GenBank No. KP295475.1) and synthesized by Sangon Biotech, Shanghai, China