Skip to main content

Advertisement

Table 3 Names and sequences of TFV-encoded miRNAs

From: Identification and differential expression analysis of MicroRNAs encoded by Tiger Frog Virus in cross-species infection in vitro

Name Sequence Length
TFV-miR-01 5’- GTTGCGGTGCCTGGGGTCGGGA -3’ 26
TFV-miR-02 5’- AGACGGTCGGGCTTGACGTTGAG -3’ 27
TFV-miR-03 5’- GCGGGCACAGGGTGGTGACTTT -3’ 26
TFV-miR-04 5’- GCTGGTGTAGATGGTGCCTGTCC -3’ 27
TFV-miR-05 5’- AGACAGCTGCCTGACGTGAAA -3’ 25
TFV-miR-06 5’- AGGCGGTGGCGTCGTAGGTCTTG -3’ 27
TFV-miR-07 5’- GGACCTGCCGTCGGGGACGTG -3’ 25
TFV-miR-08 5’- AGTCTCGGGCCTGAAGGGAAGGAC -3’ 28
TFV-miR-09 5’- GTAGGCCTTGACGCACCTGACGTG -3’ 28
TFV-miR-10 5’- AGGCTGATGTCCATGTCGTCG -3’ 25
TFV-miR-11 5’- TGAGGGTGACCTGACAGGGCTGT -3’ 27
TFV-miR-12 5’- GAGCCAAGTCTGCCTGTCGTCGGC -3’ 28
TFV-miR-13 5’- GGACGTCCCCGCGCCCGTGCTG -3’ 26
TFV-miR-14 5’- CCTGCACACGGGGTCGGACGCCA -3’ 27
TFV-miR-15 5’- GAGTCTCTCTTGTTGGTCTTTGG -3’ 27
TFV-miR-16 5’- CCCACTGGACGGGCTCGGACGGCC -3’ 28
TFV-miR-17 5’- CAACGGGACTGTGGGGTTGAG -3’ 25
TFV-miR-18 5’- GCTCAGGGCGGTGGAGTAGGT -3’ 25
TFV-miR-19 5’- TGTGCGCCCAGGAGCTGTCTGT -3’ 26
TFV-miR-20 5’- CCCACGGCGGGGGGGACAATGT -3’ 26
TFV-miR-21 5’- AGAGATTGGTCCTGAAGAGTTT -3’ 26
TFV-miR-22 5’- AGACGTTGGCCTCGACGGTGTCGG -3’ 28
TFV-miR-23 5’- TCTCGGGGTCGATGGAATTTG -3’ 25
TFV-miR-24 5’- GGGTCCGCGTACAGCAGCGACG -3’ 26