Skip to main content

Table 1 Species-specific primer pairs used for identification of individual tospoviruses

From: Monoclonal antibodies for differentiating infections of three serological-related tospoviruses prevalent in Southwestern China

Virus Primer name Sequence (5′→3′) Position at S RNA
Calla lily chlorotic spot virus (CCSV) CC-f GTGCTGCATAATGGAATTCAGCTG 2670–2693
CC-r GACTCTGGGATTCAATTTCAGT 2998–3019
Tomato necrotic spot associated virus (TNSaV) TN-f TGAGAGTAACGGGAGCGGACCACCT 2731–2755
TN-r AGGAAACAAGTGTTTGCTGCATG 3013–3035
Tomato zonate spot virus (TZSV) TZ-f GGCCATGCTGATAAGTCTAGTCCT 2889–2912
TZ-r ACCCAAGGCTTCAGCTTTGCCT 3104–3125