Skip to main content

Advertisement

Table 3 Primers used in real time PCR

From: Avian leukosis virus subgroup J induces its receptor--chNHE1 up-regulation

Gene Primer Primer sequence Size of PCR product
gp85 Pf GTCACTAATGTTACTGCTTGCG 434 bp
Pr GAACTACACCAATTAGAAAG
chNHE1 Pf CTGAACAAACAGCACCACAAC 291 bp
Pr GAGGAGGAAGAGGAAGAAGATG
GAPDH Pf GGTGGTGCTAAGCGTGTTA 179 bp
Pr CCCTCCACAATGCCAA
  1. The gp85 primers were used for detecting the mRNA level expression of ALV-J