Skip to main content

Table 3 Primer sequences and reaction conditions for the BGS, MSP and RT-PCR experiments

From: Serine/threonine kinases 31(STK31) may be a novel cellular target gene for the HPV16 oncogene E7 with potential as a DNA hypomethylation biomarker in cervical cancer

Primer sequence Size (bp) Temperature (°C)
STK31-BGS F: 5ʹ-TTTTTAAAGTTATAGTTTGAAGTTTTG- 3ʹ 499 50
R: 5ʹ- ACATCTAACACCCCTCTAAAATAAC - 3ʹ
STK31-M F: 5ʹ- TTGTTACGTGATTTTCGTTAATATC - 3ʹ 149 51
R: 5ʹ-TAAACCCACATACTAAACTTTCGAC - 3ʹ
STK31-U F: 5ʹ-GTTATGTGATTTTTGTTAATATT - 3ʹ 147 51
R: 5ʹ-TAAACCCACATACTAAACTTTCAAC - 3ʹ
STK31-RT F: 5′-AGAGGAATATGAGATGCTAACTA - 3′ 111 60
R: 5′- GTAAGGAGACCACCAGAG - 3′
GAPDH F: 5′- GATGACCTTGCCCACAGCCT - 3′ 303 60
R: 5′- ATCTCTGCCCCCTCTGCTGA - 3′