Skip to main content

Table 2 The primer sequences and product size of MY09/11, GP5+/6+ and SPF1/2

From: Serine/threonine kinases 31(STK31) may be a novel cellular target gene for the HPV16 oncogene E7 with potential as a DNA hypomethylation biomarker in cervical cancer

Primer sequence Size (bp)
MY09/11 F: 5ʹ- CGTCCMARRGGAWACTGATC- 3ʹ 450
  R: 5ʹ- GCMCAGGGWCATAAYAATGG- 3ʹ  
GP5+/6+ F: 5ʹ- TTTGTTACTGTGGTAGATACTAC- 3ʹ 150
  R: 5ʹ- GAAAATAAACTGTAAATCATATTC - 3ʹ  
SPF1A F: 5ʹ- GCiCAGGGiCACAATAATGG - 3ʹ 65
SPF1B R: 5ʹ- GCiCAGGGiCATAACAATGG - 3ʹ  
SPF1C F: 5′- GCiCAGGGiCATAATAATGG - 3′  
SPF1D R: 5′- GCiCAAGGiCATAATAATGG - 3′  
SPF2B-bio F: 5′-GTiGTATCiACAACAGTAACAAA - 3′  
SPF2D-bio F: 5′-GTiGTATCiACTACAGTAACAAA- 3′