Skip to main content

Advertisement

Table 1 Primers for PTV and PICV

From: Development of real-time reverse transcriptase qPCR assays for the detection of Punta Toro virus and Pichinde virus

Virus Primers/probe Sequence (5’-3’) Conc. (μM) Amplicon
  F3512 CATGTGTGGCCCCCATTT 0.5 63 bp
PICV R3574 TCAGTTGTTAGGCAAAGTGGTCTT 0.5  
  P3532S-MGB 6FAM-AATGGTCCATTGACACGG-MGBNFQ 0.2  
  F430 CAGATAGCTGCTGCCATTTTACA 0.5 66 bp
PTV R495 GCTTTTAAGTTTCCCAGCCAAA 0.5  
  P454S-MGB 6FAM-CTCATTATTGTGGGCTCAT-MGBNFQ 0.2