Skip to main content

Table 1 Primers and conditions for real-time RT-PCR

From: Human H7N9 virus induces a more pronounced pro-inflammatory cytokine but an attenuated interferon response in human bronchial epithelial cells when compared with an epidemiologically-linked chicken H7N9 virus

Cytokines Primers      
  Forward Backward Mg conc. (mM) Denaturation Annealing Extension
TNF-α GCCAGAGGGCTGATTAGAGA CAGCCTCTTCTCCTTCCTGAT 2 95 °C 10s 60 °C 5 s 72 °C 5 s
MCP-1 GCAATCAATGCCCCAGTCA TGCTGCTGGTGATTCTTCTATAGCT 2 95 °C 10s 55 °C 5 s 72 °C 5 s
IL-6 GGTACATCCTCGACGGCATCT GTGCCTCTTTGCTGCTTTCAC 2 95 °C 10s 55 °C 5 s 72 °C 5 s
IFN-β GCCGCATTGACCATCT CACAGTGACTGTACTCCT 4 95 °C 10s 55 °C 5 s 72 °C 11 s
IFNL1 GAAGCAGTTGCGATTTAGCC GAAGCTCGCTAGCTCCTGTG 2 95 °C 10s 60 °C 5 s 72 °C 7 s
IL-10 CAAATGAAGGATCAGCTGGACAA GCATCACCTCCTCCAGGTAAAAC 2 95 °C 10s 55 °C 5 s 72 °C 5 s
TGF-β CCCAGCATCTGCAAAGCTC GTCAATGTACAGCTGCCGCA 2 95 °C 10s 55 °C 5 s 72 °C 5 s
IL-8 AGCTGGCCGTGGCTCTCT CTGACATCTAAGTTCTTTAGCACTCCTT 2 95 °C 10s 55 °C 5 s 72 °C 5 s
GAPDH ATTCCACCCATGGCAAATTC CGCTCCTGGAAGATGGTGAT 2 95 °C 10s 55 °C 5 s 72 °C 5 s