Skip to main content

Table 3 Primers used for complete genome sequence amplification of strain GD

From: Characterization and analysis of an infectious bronchitis virus strain isolated from southern China in 2013

Primera Location (bp) Upstream primer Downstream primer Length (bp)
1 22–1571 TATATATCTATTGCACTAGCC AGTCAGACAGACAACACGCT 1549
2 1025–1677 GCAGACTTGTTGGTGAGGTTA CACAAGTTCCGAAACACTAAA 652
3 1530–2687 TGGAGGGACATCTTTGCTAT TCTGTCTCAACTTCAATGGG 1157
4 2566–3961 TGGTGAAACTACTGTGAAGG CACACCATCTACAAGAACAT 1395
5 3642–5168 TGTTAACGCCGCAAATGAG GGCAACTTGGAATCTTCCT 1527
6 4873–6504 TAAAAAGAGTAAGAGCAAGA AGGAGACATAAGTGTATTTTG 1631
7 6534–7920 CGTCTACACTAACTCAGGCTA CCTGACTCCACTAGGTTGAA 1386
8 7890–9260 GAAATTGTTGGTTACACCCAC TAGAACGCATAGTAACGGGG 1370
9 9247–10664 TCAGTAGGCGTTTGAAAGG ATAGGCAACACACGGTCA 1417
10 10594–12110 GGCATAGGTTGGATGTTTACT CACAGAAGCCCCTCCGTAA 1516
11 11954–12523 GTCTTACAGTCTAAAGGAT AGCACAGTTACGCTTCAAAT 569
12 12418–13418 ACTTAGACAACCAAAACCCTT TCATAATAACACCGAGTTCCT 1000
13 13261–13978 CCCTCCTCAAGTATGATTAT ATAGTGGGCAGGACATTCTT 717
14 13865–15044 TATTTTGTTTAGAGGTGACG AGGAATAGTCAATAAGCAT 1179
15 14712–16138 CTGATTCTAAGTGTTGGGTT TCCTTTGAGGTACTATGCGA 1427
16 15516–16465 ACTCGCTAAGACGCTTTGCT TTAGGACAACGGTAACACTTC 950
17 16283–17509 GTGACATTCTATTGGTTGAT ACAGACTTGTTCCTTGCCT 1226
18 17503–19024 TCACTTGAGAGCTTTGT TAAACATACAGATTCGCT 1521
19 18628–19634 ATCAAACAACTCTGCCTACA CCACATTCATCATAATACCACT 1007
20 18945–20442 AAGCGGTATYCNTATGTAGA ATAGTRCAVACAAAAKRGTCA 1498
21 20189–20578 TTATTTGGGTGACAGTGG ACCACTAATAATACCAACAG 389
22 20437–22232 AAGGTTAATCCCTGTGAAG AGTYTCVGTAAGAATAGCA 1795
23 21873–22919 AAGGTTAATCCCTGTGAAG AGTYTCVGTAAGAATAGCA 1047
24 22723–23837 CTTTTGCHACTCAGATDCA AGATTTCTTACCACACTTACT 1115
25 23791–24992 AGGGGCTTAATGACTCTCTT CTGACCTTCACAATAAAGAAC 1201
26 24796–25894 GCAGCGATAATACTTACAGT TCTGCTTGTCCTGCTTTGT 1099
27 25121–26453 GTGACCGAAGCGGAAATAA TCAGAGGAATGAAGTCCCAAC 1333
28 26891–27706 GGTGATTCTCAAGATGGTAT GCTCTAACTCTATACTAGCCT 1416
  1. aPrimer locations are indicated according to strain TW2575/98 (DQ646405)