Skip to main content

Advertisement

Table 1 Primers used in this study. Primers orf1 and orf2 [16] were used for the preliminary screening of the clinical samples. The remaining primers were used for the amplification and sequencing of the full-length A32L (825 nt) and B2L (1137 nt) genes of ORFV. The estimated PCR product sizes are presented

From: Molecular characterization of orf virus from sheep and goats in Ethiopia, 2008–2013

SI No Primer name Sequences (5'– 3') Application PCR product size (base pair)
1 Orf1 CGCAGACGTGGCTGAGTACGT PCR 140
2 Orf2 TGAGCTGGTTGGCGCTGTCCT
3 ORFV-A32f-For CTCCATTTAGAGGCCGTGAG PCR/Sequencing 1098
4 ORFV-A32f-Rev CGTGTTATGTGCCATCTTGC
5 ORFV-A32i-For GGTCGAGACAGCGCTTGA Sequencing -
6 ORFV-A32i-Rev CGTCTACAACGCCGCCTAC
7 ORFV-B2Lf-For GACCTTCCGCGCTTTAATTT PCR/Sequencing 1210
8 ORFV-B2Lf-Rev CCCGCCTGCTAAAAGACT
9 ORFV-B2Li-For GTCCGCGTTCTTCCACTC Sequencing -
10 ORFV-B2Li-Rev GCGGGCGTCAACTACTACA
11 SP6 ATTTAGGTGACACTATAG Sequencing -
12 T7 TAATACGACTCACTATAGGG