Skip to main content

Table 1 PCR primers of HCoV-OC43 and HCoV-HKU1

From: Molecular epidemiology and evolutionary histories of human coronavirus OC43 and HKU1 among patients with upper respiratory tract infections in Kuala Lumpur, Malaysia

Target gene HCoV Primer Locationa Sequence (5'-3') Reference
Spike (S) OC43 LPW 1261 24010-24029 Forward: CTRCTATARYTATAGGTAGT [11]
   LPW 2094 24866-24887 Reverse: GCCCAAATTACCCAATTGTAGG [11]
  HKU1 LPW 1832 23275-23299 Forward: TATGTTAATAAWACTTTGTATAGTG [40]
   LPW 1866 24197-24218 Reverse: TACAATTGACAAGAACTAGAAG [40]
Nucleocapsid (N) OC43 & HKU1 βN-F OC43: 28974-28996 Forward: GCTGTTTWTGTTAAGTCYAAAGT this study
    HKU1: 28218-28240   
   βN-R OC43: 30479-30501 Reverse: CATTCTGATAGAGAGTGCYTATY this study
    HKU1: 29699-29721   
   βN-Fn OC43: 29046-29069 Forward (nested): GCMTTGTTRAGARMTWAWATCTAA this study
    HKU1: 28287-28310   
   βN-Rn OC43: 30447-30466 Reverse (nested): GCGAGGGGTTACCACCWRRT this study
    HKU1: 29671-29690   
1a OC43 OC43-1aF 6145-6167 Forward: CTTTTGGTAAACCTGTTATATGG this study
   OC43-1aR 7329-7351 Reverse: AGCTTAATAAAAGAGGCAATAAT this study
   OC43-1aFn 6183-6199 Forward (semi-nested): GCTTCYCTCAATTCTTTAACAT this study
  HKU1 HKU1-1aF 6448-6471 Forward: TTCTCTTACTTATTTTAATAAACC this study
   HKU1-1aR 7587-7610 Reverse: CTTTATACATAGCAGTAACAACTA this study
  1. aNucleotide location was determined based on the HCoV-OC43 ATCC VR-759 (AY585228) and HCoV-HKU1 (NC_06577) reference sequences
\