Skip to main content

Table 1 Novel miRNA candidates identified from whitefly B. tabaci MEAM1

From: MicroRNA profiling of the whitefly Bemisia tabaci Middle East-Aisa Minor I following the acquisition of Tomato yellow leaf curl China virus

Name Sequence (5′-3′) Length (nt) miRDeep2 score Reads in libraries
Nonviruliferous Viruliferous
bta-miRn16 caagauggagguuuacugguucu 23 971.7 140 1114
bta-miRn17 ccuaaaucagagaucuuugacg 22 213.1 81 121
bta-miRn18 uuggccauccugacaccccuug 21 99.6 13 102
bta-miRn19 caaagucuaagauuuuuugcg 21 21.2 5 20
bta-miRn20 ugucgugaugauuuucau 18 4.2 4 8
bta-miRn21 cgucgcauggcgcuugugaua 21 4.1 1 4
bta-miRn22 uuacguacucaaacaacacaag 22 4 35 143