Skip to main content

Advertisement

Table 1 Primer sequences and PCR product sizes

From: Simultaneous detection of eight immunosuppressive chicken viruses using a GeXP analyser-based multiplex PCR assay

Virus Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′) Amplicon size (bp) Target region Primer concentration (μM)
MDV AGGTGACACTATAGAATAAGGGAGCAGACGTACTATGTAGACAA GTACGACTCACTATAGGGATGGTAAGCAGTCCAAGGGTCA 227 meq 0.16
ALV-A AGGTGACACTATAGAATACAAGGGGTTCCTTGGTATCT GTACGACTCACTATAGGGATGTGCCTATCCGCTGTCA 155 gp85 0.2
ALV-B AGGTGACACTATAGAATATCAATCACGATTCTCCCACC GTACGACTCACTATAGGGATGTGACGCTTCGTTTACGTCTT 285 gp85 0.2
ALV-J AGGTGACACTATAGAATACTGATGCAACAACCAGGAAA GTACGACTCACTATAGGGAGCAGTAACATTAGTGACATACCC 204 gp85 0.2
REV AGGTGACACTATAGAATAGACCAGGCGAGCAAAATC GTACGACTCACTATAGGGAGGTGTAATAGGTAGGTATGGAGGA 182 gp90 0.2
IBDV AGGTGACACTATAGAATAGGGTCAGGGCTAATTGTCTT GTACGACTCACTATAGGGATCTGTCAGTTCACTCAGGCTTC 294 VP2 0.2
CIAV AGGTGACACTATAGAATAAAAGGCGAACAACCGATGA GTACGACTCACTATAGGGATGCCCTGGAGGAAAAGACC 269 VP1 0.2
ARV AGGTGACACTATAGAATAGGACCCCTACTTCTGTTCTCA GTACGACTCACTATAGGGAATTTCCCGTGGACGACAT 215 S1 0.16
Universal primers AGGTGACACTATAGAATA GTACGACTCACTATAGGGA    0.25
  1. Universal primers sequences are underlined. Chimeric primers were synthesised using universal primers and specific primers