Skip to main content

Table 1 Primers used in this study

From: Construction and immune efficacy of recombinant pseudorabies virus expressing PrM-E proteins of Japanese encephalitis virus genotype І

Primer Sequence 5' → 3'
JEF(Forward)a TTG GAATTC ATG ATA AGA GGA GGG AAT G
JER(Reverse)a TTT AGATCT TTA GGC ATG CAC ATT GGT CG
JEVeFb GAT CTG TCG TAGCTCTTGGGTCACAG
JEVeRb GCGTTGACACCCATCCAAAGAAG
IFN-γ-Fc TGGCATAGATGTGGAAGAA
IFN-γ-Rc GTGTGATTCAATCAATGACGCTTA
GAPDH-Fd GCCCAAGATGCCCTTCAGT
GAPDH-Rd CCTTCCGTGTTCCTACCCC
  1. aPrimers used to the clone the PrM-E gene; bPrimers used for the identification of recombinant virus PRV TK/gE/PrM-E+; cThe special primers for analysis of IFN-γ mRNA expression through real-time RT-PCR; d: Primers used for the control of real-time RT-PCR