Skip to main content

Table 2 Oligonucleotide sequences of primers and probes

From: Mechanisms downstream of reverse transcription reduce serum levels of HBV DNA but not of HBsAg in chronic hepatitis B virus infection

Target Oligo Sequencea Nucleotide positionb
S-RNA Forward primer TCCTCCAAYTTGTCCTGGTYATC 350–372
  Reverse primer AGATGAGGCATAGCAGCAGGAT 432–410
  Probe (AS) ATGATAAAACGCCGCAGACACATCCARC 400–373
pgRNA Forward primer GGTCCCCTAGAAGAAGAACTCCCT 2367–2390
  Reverse primer CATTGAGATTCCCGAGATTGAGAT 2454–2431
  Probe TCTCAATCGCCGCGTCGCAGA 2408–2428
cccDNA Forward primer CCGTGTGCACTTCGCTTCA 1575–1593
  Reverse primer GCACAGCTTGGAGGCTTGA 1882–1864
  Probe CATGGAGACCACCGTGAACGCCC 1607–1629
  1. aY, T or C; R, A or G; AS, antisense
  2. bPosition in genotype A genome