Skip to main content

Table 2 Primer sets for genome amplification

From: Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations

Set Forward Reverse Nucleotide positiona
F1/R1 GAGAACAAGGTCAGGGTTCAG TTGCCGGCAGATCTTCTAAC 77–1231
F2/R2 TGCTATGGGAGTTGGTGTTG TCTTCGCCAGAATCCTCAGT 1112–2273
F3/R3 CGAAGATGCTGACAGTCTCG GAAAGCAGTTCTGTGCCTGTT 2169–3368
F4/R4 CAAAGTCACAAACACAACATGC GGGACTGATGGTTGCAAGAC 3223–4372
F5/R5 TGTTACCCGCTCATGGAGAT CCAAGTACTGGTGACTGGGTCT 4272–5433
F6/R6 GGTGCATTGGAATAGCCAGT GCAGGTATCGGAGGCAATAA 5299–6530
F7/R7 CTTGGTGTCTGGGACGATG GCTGCCGATGCAATAGATTT 6377–7578
F8/R8 GGTTACGGTTGCCACAAAAA TCCATAATCTGGGATGTTTGAA 7389–8580
F9/R9 AAGAACGGAACAGTCCTTGG TTGTGACTGGTGAGGTCAATG 8441–9685
F10/R10 TGCAAAGCTCACAGTGGTTC CAGGCTCGCATTTTGTAGGT 9496–10696
F11/R11 GAGGACTCTCAGTTTGACCCTTA CACATCCCGTGTCATAGCTG 10539–11777
F12/R12 CCGCATGCAGTAACATTTCA GCCCATGAGTACACAGTTGCT 11626–12772
F13/R13 TACATCGGGTCCACAACAGA CCTCATCACTTTCGCACAAA 12663–13821
F14/R14 CACGGACCCTCTCTTGACTC CGAGGTAGGCCTCTGTTGAC 13683–14901
F15/R15 GCGACTGGGTTCAAGGATTTA AGCAATGAATAGCAGAGGGTTAG 14797–15623
  1. aReference genome AF164967 (A75/17)