Skip to main content

Table 1 Primers used in this study

From: Molecular cloning of Peking duck Toll-like receptor 3 (duTLR3) gene and its responses to reovirus infection

Primer Sequence of oligonucleotide (5′ → 3′) Application
TLR3-F AGCCATGGGAAGTGATATTCT Gene cloning
TLR3-R CGCTCACCGTGCTTTACTATTAGAT
3′ RACE outer primer TACCGTCGTTCCACTAGTGATTT RACE PCR
TLR3-3GSP1 GGATAGCTTTCTACTGGAACATT
3′ RACE inner primer CGCGGATCCTCCACTAGTGATTTCACTATAGG
TLR3-3GSP2 AACGGGACTTTGAAGCAGGCGTATC
5′ RACE outer primer CATGGCTACATGCTGACAGCCTA
TLR3-5GSP1 GTTGCAATCCTAAATTTGCTGACTT
5′ RACE inner primer CGCGGATCCACAGCCTACTGATGATCAGTCGATG
TLR3-5GSP2 CAGGGGCAAATTTTTGCACAGTTC
TLR3-5GSP1 GTTGCAATCCTAAATTTGCTGACTT
qTLR3-F ATGTCATGCAAACCTGACCA Real-time quantitative PCR
qTLR3-R CCAGGGTCTTGAAAGGATCA
qNFκB-F TGTCAGCCTTCTGGATCGCCACG
qMx-F CATGGTTGTGAAGTGTCGTGGTC
qMx-R TATTGTGGGTGTGCCTCGTCTGT  
qNFκB-F TGTCAGCCTTCTGGATCGCCACG
qNFκB-R GCCCGCCAAGGGGATGTTTTCTA
qIFN-α-F GGGCCCCGCAACCTT
qIFN-α-R CTGTAGGTGTGGTTCTGGAGGAA
qISG12-F AAAATGGCTGACCGAAACGT
qISG12-R TGTGTGAAGCAAGCGAACCT
qOASL-F GACCAACACACACTGCAGCACTA
qOASL-R CCGTAGCCGCAGAAGCA
qIFITM1-F CACCGCCAAGTACCTGAACA
qIFITM1-R CGATCAGGGCGATGATGAG
qACTß-F CCCCATTGAACACGGTATTGTC
qACTß-R GGCTACATACATGGCTGGGG