Skip to main content

Table 3 LAMP primers sequence

From: Rapid detection of the common avian leukosis virus subgroups by real-time loop-mediated isothermal amplification

Primer Sequence (5’-3’) Genome position
F3 TGATTTGGGGGCAAGTGTAC 4148-4167
B3 ATGACTCCGCACGTGGAG 4356-4373
FIP = F2+ F1c CTACATTAGTGGGCGCTGTCGG-AACAACTGGAAGCACGCG F2, 4168-4185 F1c, 4212-4233
BIP = B2 + B1c TCAAGATGGGACAGGAGGGAGT-TTTGGCTTAACGCATCCTCT B2, 4316-4335 B1c, 4267-4288