Skip to main content

Table 1 Real-time PCR primers

From: Interleukin-27 ameliorates coxsackievirus-B3-induced viral myocarditis by inhibiting Th17 cells

Gene Primer sequence (5′-3′)
IL-27RA Forward: CAAGAAGAGGTCCCGTGCTG
  Reverse: TTGAGCCCAGTCCACCACAT
IL-17A Forward: CTCCAGAAGGCCCTCAGACTAC
  Reverse: AGCTTTCCCTCCGCATTGACACAG
IL-22, Forward: CATGCAGGAGGTGGTACCTT
  Reverse: CAGACGCAAGCATTTCTCAG
ROR-γt Forward: ATGACATGCACCTGGAACACT
  Reverse: TGTGAGTTCTCCATGCCTAGG
CVB3 Forward: ATCAAGTTGCGTGCTGTG
  Reverse: TGCGAAATGAAAGGAGTGT
β-actin Forward: CACCATTGGCAATGAGCGGTTC
  Reverse: GTAGTTTCGTGGATGCCACAG