Skip to main content

Table 1 Primers used in the present study

From: Interferon lambda inhibits dengue virus replication in epithelial cells

Gene name and accession number in GenBank Sequence (5′–3′) UPL sequence (UPL#)a Amplicon bp Alignmentb
MX1 TCCAGCCACCATTCCAAG TTCTCCTG (2) 60 868–885
NM_001144925.2 CAACAAGTTAAATGGTATCACAGAGC 927–902
OAS1 GGTGGAGTTCGATGTGCTG CCAGGGCA (37) 64 538–556
XM_006719434.1 AGGTTTATAGCCGCCAGTCA 601–582
IFN-β CTTTGCTATTTTCAGACAAGATTCA CTGGCTGG (20) 69 336–360
NM_002176.2 GCCAGGAGGTTCTCAAGAAT 404–389
IFN-λ1 TCCTAGACCAGCCCCTTCA c 73 435–453
NM_172140.1 GTGGGCTGAGGCTGGATA 507–490
IFN-λ2 CCTGGTGGACGTCTTGGA c 84 406–423
NM_172138.1 GTGGGCTGAGGCTGGATA 489–472
IFN-λ3 AGGGCCAAAGATGCCTTAG c 123 167–185
NM_172139.2 CAGCTCAGCCTCCAAAGC 298–281
HPRT1 127
NM_000194.2d
  1. aUPL: Universal Probe Library, Roche Life Science. Number of the probe is in parentheses
  2. bPosition of primers in the corresponding gene sequences
  3. cSybrGreen dye was used
  4. dSpecific gene positions and sequences of Applied Biosystems primers and probes are not disclosed