Skip to main content

Table 1 Predicted citrus mRNAs annotated as transcripts and targeted by HSVd-siRNAs

From: Identification of Hop stunt viroid infecting Citrus limon in China using small RNAs deep sequencing approach

HSVd-siRNA No. sRNA 5′-enda Alignmentb Scorec Citrus transcript targetd Target predicted function
1 103 siRNA GAGAGAGGAUGCGGAGAGCGA 2.0 Orange1.1 g021690 E3 ubiquitin-protein ligase RING1-like
   ..    
   Target CUCUCUCCGACGUCUCUUGCU    
2 102 siRNA AGAGAGGAUGCGGAGAGCGAC 2.0 Cs5g11500.1 Cysteine--tRNA ligase
      
   Target UCGCUCCUACACCUCUCGCUC    
3 198 siRNA UCUUCCAUUUUCUUCUUCCCU 2.0 TC24583 COP9 signalosome complex subunit 6a
   . .    
   Target AGAAGGAGGAAGAAGAAGGGA    
4 105 siRNA GGAGAGAGGAUGCGGAGAGC 2.0 Cs8g10955.1 S-adenosylmethionine synthase 3
      
   Target CUCUCUCCGACGUCUCUUGCU    
5 199 siRNA CUUCCAUUUUCUUCUUCCCUG 2.0 EY709257 Pherophorin-C1 protein
      
   Target GAACGUAAAAGAAGAAGGGAG    
  1. aLocation of HSVd-siRNA 5′ termini in the viroid genome
  2. bAlignments between HSVd-siRNAs with predicted citrus mRNAs. HSVd-siRNAs were shaded in red
  3. cThe score of the complementarity between small RNA and their target transcript following the scoring schema of miRU by Zhang [22]
  4. dThree Citrus sinensis database (transcript, cDNA, and Unigene) from the psRNATarget website were used for prediction