Skip to main content

Advertisement

Table 3 Nucleotide sequences of the primer

From: Rescue of a duck circovirus from an infectious DNA clone in ducklings

Primersa Sequences (5′-3′)b Usage
IC-1F CCCAAGCTTGGAACTGGACCAAC Fragment clone
IC-1R TCCGGATCCGAAAAATCCAAATAC  
IC-2F TTCGGATCCGGAACTGGACCAAC Fragment clone
IC-2R TCCGAATTCGAAAAATCCAAATACGG  
IC-MuF GATCAGGTGACGAAGGCGCTCGAGGCCACGCCCAAAG Genetic marker
IC-MuR CTTTGGGCGTGGCCTCGAGCGCCTTCGTCACCTGATC  
PD-F TGAACCCGGTGAACTGACC Genetic marker detection
PD-R ATGCGACGCAGCACCTATC  
SYBR-F ACTGACGTTGCCCGGAAGTA Quantitate virus stock
SYBR-R TCTTCCAATCACGTTGCGTTT  
  1. aF denotes forward PCR primer; R denotes reverse transcription or reverse PCR primer
  2. bItalics and underlines stand for restriction enzyme site