Skip to main content

Advertisement

Table 2 Primers and probes used for PCR and real-time PCR analysis

From: Induction of neutralizing antibodies specific for the envelope proteins of the koala retrovirus by immunization with recombinant proteins or with DNA

Primer Sequence
KoRV-for AGAATTCGAACCCTCACCAACCCATGACTC
KoRV-rev AAAGTCGACGGCGGTCGAGCCGGTACC
KoRV-gp70-for ATAAGATCTATGCTTCTCATCTCAAACCC
KoRV-gp70-rev AAAGTCGACGGCGGTCGAGCCGGTACC
KoRV-gp85-rev ATAGTCGACGGGGGAACGGTTGAACC
KoRV-5-for CTAATAAAAGGGCCCATAGA
KoRV-6-rev GTTGAACCATCCCTCGTACC
KoRV probe 6Fam-CCATGGATACAGACCTTAGGGCCC-BHQ1