Development and application of SYBR Green I real-time PCR assay for the separate detection of subgroup J Avian leukosis virus and multiplex detection of avian leukosis virus subgroups A and B

Table 6 Primers used in this study

Purpose	Name	Sequence (5′-3′)	Amplicon size (bp)
env gene amplification of ALV- A/B strains	A/B-F	CACGGTTCCTCCTTAGACA	242
env gene amplification of ALV- A/B strains	A/B-R	CCGATTAACCCATATCCCTCC	242
env gene amplification of ALV J strain	J-F	TGTGTGCGTGGTTATTATTTC	144
env gene amplification of ALV J strain	J-R	AATGGCGAGGTCGCTGACTGC	144
GAPDH gene amplification of chicken	G-F	GAACATCATCCCAGCGTCCA	112
GAPDH gene amplification of chicken	G-R	CGGCAGGTCAGGTCAACAAC	112

ISSN: 1743-422X