Skip to main content

Advertisement

Table 2 Primers used for amplicon generation

From: A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library

a. Barcode sequences
Barcode Sequence (5′→3′)
RL1 ACACGACGACT
RL2 ACACGTAGTAT
RL3 ACACTACTCGT
RL4 ACGACACGTAT
RL5 ACGAGTAGACT
RL6 ACGCGTCTAGT
RL7 ACGTACACACT
RL8 ACGTACTGTGT
RL9 ACGTAGATCGT
RL10 ACTACGTCTCT
RL11 ACTATACGAGT
RL12 ACTCGCGTCGT
RL13 AGACTCGACGT
RL14 AGTACGAGAGT
RL15 AGTACTACTAT
RL16 AGTAGACGTCT
b. HIV-1 sequences common to WT and MK transcripts
Primer Sequence Amplicon length (nt)
G1(2945)Fw 5′ GAGATGGGTGCGAGAGCGTC 3′ 370
G1(3314)Rv 5′ TGTGTCAGCTGCTGCTTGCTG 3′
G2(3236)Fw 5′ ACCAAGGAAGCCTTAGATAAGATAGAGGAAGAG 3′ 444
G2(3679)Rv 5′ TGAAGGGTACTAGTAGTTCCTGCTATGTCACTTC 3′
G3(3584)Fw 5′ GATAGATTGCATCCAGTGCATGCAG 3′ 372
G3(3955)Rv 5′ GCTTTTAAAATAGTCTTACAATCTGGGTTCGC 3′
G4(3793)Fw 5′ TCTGGACATAAGACAAGGACCAAAGG 3′ 403
G4(4195)Rv 5′ ACATTTCCAACAGCCCTTTTTCCTAG 3′
  1. Barcoded primers were designed so that marker points were amplified as 4 overlapping areas within the gag region of HIV-1. Primers were designed with (a) unique barcodes at the 5′ end; followed by (b) regions that were identical between both WT and MK cDNA sequence.