Skip to main content

Table 2 Primers and probes used for the duplex real-time PCR assay

From: A duplex real-time PCR assay for the detection and quantification of avian reovirus and Mycoplasma synoviae

Primer/probe name Primer/probe sequence Target gene Amplicon length
ARV F 5’-CGTTCCCTGTGGACGTATCA-3’ σC 69 bp
ARV R 5’-GAGTACACCCCATACGCTTGGT-3’
ARV P 5’-(FAM) TCACCCGCGATTCTGCGACTCAT (Eclipse)-3’
MS-F 5’-ATAGCAATTTCATGTGGTGATCAA-3’ vlhA 143 bp
MS-R 5’-TGGATTTGGGTTTTGAGGATTA-3’
MS-P 5’-(ROX) CAGCACCTGAACCAACACCTGGAA (Eclipse)-3’