Skip to main content

Table 2 Details of the primers used for the molecular detections and quantifications of CEVd and HSVd

From: Multiplex detection, distribution, and genetic diversity of Hop stunt viroid and Citrus exocortis viroid infecting citrus in Taiwan

Primer pairs for multiplex RT-PCR
Primer name Sequence 5′-3′ Product size (nt) Position Description References
CEVd-dF28 GCTCVCCYGACCCYGCRa 371 28-44 Full-length cDNA for sequencing and qPCR This work
CEVd-dR27 HCCACAGGRACCTCAAGa 11-27
CEVd-F194 TTTCGCTGCTGGCTCCACA 196 194-212 RT-PCR
CEVd-R18 ACCTCAAGAAAGATCCCGA 371-18
HSVd-F1 GGGGCAACTCTTCTCAGAATCC 302 81-102 RT-PCR [8]
HSVd-R1 GGGGCTCCTTTCTCAGGTAAGTC 58-80
Primers/Probes for multiplex real-time RT-PCR
Primer name Sequence 5′-3′ Product size (nt) Position Description References
CEVd-RTR_F GTCGCCGCGGATCACT 64 142-159 Real-time PCR This work
CEVd-RTR_R CCAGCAGCGAAAGGAAGGA 187-205
HSVd-RTR_F GGAATTCTCGAGTTGCCGCA 127 5-24
HSVd-RTR_R CCGCGGCCCTCTCT 118-131
Probe name Sequence 5′-3′   Position 5′-Labeled
CEVd-RTR_P CCAGCGGAGAAACAG 163-177 FAM
HSVd-RTR_P CAACTCTTCTCAGAATCC 85-102 IC
  1. aR = AG, Y = CT, H = ACT, V = ACG.