Skip to main content

Table 1 Primers used for the generation of E1/E2 area of HCV genotype 4

From: New insight into HCV E1/E2 region of genotype 4a

Primers Polarity Sequences (5′-3′) Application Product size
HCV outer 2 Antisense CACCAGCGGGTGAAGCAGCATTGA RT/1st round PCR  
HCV outer 1 Sense GGACGGGGTAAACTATGCAACAGG 1st round PCR 1804 bp
HCV inner 2 Antisense GACAGTTACGCCTGAACTTGACTTACCATAAACATC 2nd round PCR  
HCV inner 1 Sense CACCCATGGGTTGCTCTTTTTCTATC 2nd round PCR 1726 bp