Skip to main content

Table 1 Sequences of primers for real-time RT-PCR

From: IL-22-producing Th22 cells play a protective role in CVB3-induced chronic myocarditis and dilated cardiomyopathy by inhibiting myocardial fibrosis

Molecule Sequence (5’ ~ 3’)
COL1-A1 sense: CGCCATCAAGGTCTACTGC
GenBank: 12842 anti-sense: GAATCCATCGGTCATGCTCT
COL3-A1 sense: GTGGCTCTAATGGCATCAAAG
GenBank: 12825 anti-sense: ATGTGGTCCAACTGGTCCTCTG
MMP9 sense: TGGGACCATCATAACATCAC
GenBank: 17395 anti-sense: GATACCCGTCTCCGTGCT
TIMP-1 sense: CTTGGTTCCCTGGCGTACTC
GenBank: 21857 anti-sense: ACCTGATCCGTCCACAAACAG
β-actin sense: AATTCCATCATGAAGTGTGA
GenBank: 11461 anti-sense: ACTCCTGCTTGCTGATCCAC