Skip to main content

Advertisement

Table 2 The primers used for PCR or real-time quantitative PCR in this study

From: Inhibition of porcine reproductive and respiratory syndrome virus infection by recombinant adenovirus- and/or exosome-delivered the artificial microRNAs targeting sialoadhesin and CD163 receptors

Gene Primer pair Sequence (5′→3′) Amplicon (bp)
Sn For1 CTAGATCTATGGACTTCCTGCTCCTGCT 1751
Rev1 CTGTCGACCTGGTGCTGTGGCTGTTCTG
For2 AGCAGCCGAACGCAGGAT 201
Rev2 TTCTGGTCTTTGAGCTTCGTCC
CD163 For1 CTCTCGAGATGGTGCTACTTGAAGACTC 1511
Rev1 CTGGATCCTCCAGAGAGAAGTCAGAATC
For2 ATTCATCATCCTCGGACCCAT 110
Rev2 CCCAGCACAACGACCACCT
PRRSV For CCAGCCAGTCAATCARCT 208
ORF7 Rev GCGAATCAGGCGCACWGTATG
GAPDH For ACACTCACTCTTCTACCTTTG 90
Rev CAAATTCATTGTCGTACCAG