Skip to main content

Table 3 Sequences of primers used in the study

From: Multiplex PCR analysis of clusters of unexplained viral respiratory tract infection in Cambodia

FLUA-F GTCTTCTAACCGAGGTCGAAACG
FLUA-R GCATTTTGGACAAAGCGTCTACG
FLUB-F CACAGCAAAAACAATGAATGGA
FLUB-R AGCACTTCCATTACATCCTTTGC
RSVA-F AGATCAACTTCTGTCATCCAGCAA
RSVA-R GCACATCATAATTAGGAGTATCAAT
RSVB-F AAGATGCAAATCATAAATTCACAGGA
RSVB-R TGATATCCAGCATCTTTAAGTATCTTTATAGTG
Coronavirus229E-F GGCGCAAGAATTCAGAACCA
Coronavirus229E-R TAAGAGCCGCAGCAACTGC
CoronavirusOC43-F TGTGCCTATTGCACCAGGAGT
CoronavirusOC43-R CCCGATCGACAATGTCAGC
HPIV1-F TACTTTTGACACATTTAGTTCCAGGAG
HPIV1-R CGGTACTTCTTTGACCAGGTATAATTG
HPIV2-F GGACTTGGAACAAGATGGCCT
HPIV2-R AGCATGAGAGCYTTTAATTTCTGGA
HPIV3-F GCTTTCAGACAAGATGGAACAGTG
HPIV3-R GCATKATTGACCCAATCTGATCC
HPIV4A-F AACAGAAGGAAATGATGGTGGAAC
HPIV4A-R TGCTGTGGATGTATGGGCAG
HPIV4B-F AGAAGAAAACAACGATGAGACAAGG
HPIV4B-R GTTTCCCTGGTTCACTCTCTTCA
EV/RV-F TCCTCCGGCCCCTGAATGYGGCTAAT
EV/RV-R GGAAACACGGWCACCCAAAGTA
MPV-F GCGAGARATGGGYCCHGAATCTG
MPV-R CCTGARGCATTDCCRAGAACAACAC
ADV-F CCCMTTYAACCACCACCG
ADV-R ACATCCTTBCKGAAGTTCCA
EV/RV VP4/2 round 1-F* TCIGGIARYTTCCACCACCAICC
EV/RV VP4/2 round 1-R* CTCCGGCCCCTGAATRYGGCTAA
EV/RV VP4/2 round 2-F* ACCRASTACTTTGGGTGTCCGTG
EV/RV VP4/2 round 2-R* CCGG YAAYTTCCASCACCA
EV-D68 VP1 round 1-F* AACGCCGAACTTGGYGTG
EV-D68 VP1 round 1-R* GGTAAGRGCACCAGTKGGT
EV-D68 VP1 round 2-F* TCCCTAGCTTAAAYGCAGTTG
EV-D68 VP1 round 2-R* CCAGTGGGTACRAACATTGC
Coronavirus-F* GGTTGGGAYTAYCCTAARTGTGA
Coronavirus-R* CCATCATCAGAWARAATCATCAT
RSVA-F* GGTGCAGGGCAAGTGATGTTA
RSVA-R* GCCAGCAGCATTGCCTAATAC
RSVB-F* ATGGTTCAGGGCAAGTAATGCT
RSVB-R* TCTCCTCCCAACTTCTGTGCA
  1. * indicates primers used in individual PCR assays.