Skip to main content

Table 1 Oligonucleotide primers for reverse transcription-PCR

From: Role of human heterogeneous nuclear ribonucleoprotein C1/C2 in dengue virus replication

Primer Orientation Sequence
NS1-F Sense 5′ CCGGCCAGATCTGATAGTGGTTGCGTTGTGAGC 3′
NS1-R Antisense 5′ GATCGATCGCGGCCGCTTAGGCTGTGACCAAGG AGTTAACCAAATTCTCTTCTTTCTC 3′
hnRNP C1/C2-F Sense 5′ TCGAAACGTCAGCGTGTATC 3′
hnRNP C1/C2-R Antisense 5′ TCCAGGTTTTCCAGGAGAGA 3′
DEUR Antisense 5′ GCTGTGTCACCCAGAATGGCCAT 3′
D2L Sense 5′ ATCCAGATGTCATCAGGAAAC 3′
D2R Antisense 5′ CCGGCTCTACTCCTATGATG 3′
actin-F Sense 5′ AGAAAATCTGGCACCACAAA 3′
actin-R Antisense 5′ CTCCTTAATGCTACGCACGA 3′