Skip to main content

Table 1 Primers uesd for construction of recombinant PRRSV infectious clones

From: Construction and in vitro evaluation of a recombinant live attenuated PRRSV expressing GM-CSF

Primer Nucleotide sequence (5′-3′) Sense Relative position in the genome
F1 TTCCGGAGACAGTCTTCAGC + 11143bp-11162bp
R1 TTCTGCAGCCACATTTCAATTCAGGCCTAAAGTT - 11963bp-11982bp
F2 AACTTTAGGCCTGAATTGAAATGTGGCTGCAGAA + 11963bp-11982bp
R2 TTGCATAGACCCCATTTCATCGTTCCGCTGAAACTCTGGTTAAAGGGGTTGCCGCGGAAC TTACTTTTTGACTG - 11983bp-12002bp
F3 GTTTCAGCGGAACGATGAAATGGGGTCTATGCAA + 11983bp-12002bp
R3 GAAAGGCCTCATAAGATCTTCT - 12196bp-12217bp
  1. Bold letters (nucleotides) in sequences denote the restriction enzyme sites (F1-BspE I;R3-Bgl II), and the italics in the sequence indicate the transcription-regulating sequence 6 of PRRSV(TRS6).