Skip to main content

Advertisement

Table 1 Oligonucleotides used for specific PCR systems and resulting C q -values for rhabdoviral sequences of German bats

From: Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats

Assay Primer Position (nt)* Sequence (5′-3′) in the L-gene Cq- value Reference
Rhabdo 1 rhabdo-L1-F 6-139 GAGAGTATTTTGTTGTAACTGAGC 28.5 KJ614426
  rhabdo-L1-R   GTCTAGACCTTGTCCATTGGA   
Rhabdo2 rhabdo-L2-F 3-128 TGAGGGAGTATTTCGTGATGAC 30.3 KJ614425
  rhabdo-L2-R   GTCCGCTTGATGTTTCCAGC   
Rhabdo3 rhabdo-L3-F 4-147 GAGAGACTACTTTGTCATCACTG 28.6 KJ614422
  rhabdo-L3-R   TCGTAATCATCTAGACCTTGTCC   
Rhabdo4 rhabdo-L4-F 4-123 GAGGGATTACTTTGTAATAACTGAG 31.8 KJ614427
  rhabdo-L4-R   AGCCTTGGCCATTTGATGTATTC   
Rhabdo5 rhabdo-L5-F 3-147 TTCGCGACTACTTCGTCATAAC 25.9 KJ614424
  rhabdo-L5-R   TCGTAATTGTTTAATCCCTGTCC   
Rhabdo6 rhabdo-L6-F 1-134 GCTGAGGGATTACTTTGTAATTAC 34.6 KJ614421
  rhabdo-L6-R   ATCCTTGTCCATTTGACGTGTC   
Rhabdo7 rhabdo-L7-F 1-140 GTTACGAGATTACTTTGTGATCAC 35.8 KJ614423
  rhabdo-L7-R   TGTCCAGGCCTTGTCCATTG   
  1. *Position according to reference.