Table 1 Sequences and genomic positions of putative AHV-1 miRNAs
From: Computational identification of microRNAs in Anatid herpesvirus 1 genome
No. | Predicted mature miRNA sequence (5’ to 3’) | Position, orientation | Location |
|---|---|---|---|
1 | CUCCCUUGCUUUGACAUGUCC | 26325-26345, - | Within intergenic region between UL44 and UL45 |
2 | UCGUUGGGCGGUUUCUUCGUG | 72302-72322, - | Within intergenic region between UL26 and UL27 |
3 | UUCAAACGGAGGCGUUGUGCG | 72512-72532, + | Within intergenic region between UL26 and UL27 |
4 | UUUCUGGGACCUCACCGCGGA | 79262-79282, + | Within intergenic region between UL22 and UL23 |
5 | UAAGAACUGCUGGUACCUUGC | 112559-112579, + | Within intergenic region between UL4 and UL5 |
6 | CAACGGAUGAACGUCGGCGCG | 112720-112740, - | Within intergenic region between UL4 and UL5 |
7 | CAUGGGAACAUUUAACACCCC | 123128-123148, + | Within intergenic region between ICP22 and LORF2 |
8 | UGGAUGGUUUGGAGACAGCUG | 125173-125193, + | Within intergenic region between ICP4 and ICP22 |
9 | UAUGUUUUGCCCGGGCAAAUG | 132907-132927, + | Within intergenic region between US1 and ICP4 |
10 | AAAUCUGGCGUUCGCACUCUG | 134522-134542, - | Within intergenic region between US1 and ICP4 |
11 | AUUUCGGAGUGCGAAUAUGUG | 134586-134606, - | Within intergenic region between US1 and ICP4 |
12 | GGUAGGUUGUUUGGAGAUUGC | 160321-160341, + | Within unique short terminal repeat region |