Skip to main content

Table 1 Sequences and genomic positions of putative AHV-1 miRNAs

From: Computational identification of microRNAs in Anatid herpesvirus 1 genome

No. Predicted mature miRNA
sequence (5’ to 3’)
1 CUCCCUUGCUUUGACAUGUCC 26325-26345, - Within intergenic region between UL44 and UL45
2 UCGUUGGGCGGUUUCUUCGUG 72302-72322, - Within intergenic region between UL26 and UL27
3 UUCAAACGGAGGCGUUGUGCG 72512-72532, + Within intergenic region between UL26 and UL27
4 UUUCUGGGACCUCACCGCGGA 79262-79282, + Within intergenic region between UL22 and UL23
5 UAAGAACUGCUGGUACCUUGC 112559-112579, + Within intergenic region between UL4 and UL5
6 CAACGGAUGAACGUCGGCGCG 112720-112740, - Within intergenic region between UL4 and UL5
7 CAUGGGAACAUUUAACACCCC 123128-123148, + Within intergenic region between ICP22 and LORF2
8 UGGAUGGUUUGGAGACAGCUG 125173-125193, + Within intergenic region between ICP4 and ICP22
9 UAUGUUUUGCCCGGGCAAAUG 132907-132927, + Within intergenic region between US1 and ICP4
10 AAAUCUGGCGUUCGCACUCUG 134522-134542, - Within intergenic region between US1 and ICP4
11 AUUUCGGAGUGCGAAUAUGUG 134586-134606, - Within intergenic region between US1 and ICP4
12 GGUAGGUUGUUUGGAGAUUGC 160321-160341, + Within unique short terminal repeat region