Skip to main content

Table 2 Underlined sequences represent T7 promoter and letters in boxes represent restriction enzyme Eco RI and Xho I

From: The screening and functional study of proteins binding with the BmNPV polyhedrin promoter

Primer Primer sequence
Pa 5′-GGATCCTAATACGACTCACTATAGG ATGTCGGGAGGATTAGACGT-3′
Pb 5′ GGATCCTAATACGACTCACTATAGG TTATGCAGCACTCCAGTCTT-3
P1 5′-CCGGAATTCATGTCGGGAGGATTAG-3'
P2 5'-CCGCTCGAGTTATGCAGCACTCCAG-3'
Pc 5'-GGATCCTAATACGACTCACTATAGG ATGGTTTATCGTCGCCGTCG-3'
Pd 5'-GGATCCTAATACGACTCACTATAGG TTAATAGTAGCGTGTTCTGT-3'
P3 5'-CCGGAATTCATGGTTTATCGTCGCC-3'
P4 5'-CCGCTCGAGTTAATAGTAGCGTGTTCT-3'