Skip to main content

Table 4 Nucleotide sequences of the specific primers and TaqMan probes used in this study

From: Distribution of enteroviruses in hospitalized children with hand, foot and mouth disease and relationship between pathogens and nervous system complications

Primer (5'-3') Probe (5'-3')
pan-enterovirus Forward:GCAAGTCTGTGGCGGAACC Reverse:TGTCACCATAAGCAGCCATGATA (FAM)- AATAACAGGAAACACGGACACCCAAAGTA(TAMRA)
EV71 Forward:GTTCACCTACATGCGCTTTGA Reverse:TGGAGCAATTGTGGGACAAC (VIC)-TCTTGCGTGCACACCCACCG(TAMRA)
CA16 Forward:CCTAAAGACTAATGAGACCACCC Reverse:CTAAAGGCAGCACACAATTCG (TEXAS RED)-CTTGTGCTTTCCAGTGTCGGTGCA(TAMRA)
  1. The analysis of real-time PCR data: the threshold cycle (CT) value for each sample was calculated by determining the point at which the fluorescence exceeded the threshold limit, and the cut off was 35.1 determined by the ROC curve. The results of negative, positive and quality controls which were included in each experiment were within the normal range.