Skip to main content

Table 1 Sequences of PCR primers used to construct luciferase reporter vectors containing different fragments of the human IVL promoter

From: Effects of human papillomavirus (HPV) type 16 oncoproteins on the expression of involucrin in human keratinocytes

Plasmid construct Primer sequence (5' to 3') Restriction site
pGL3-IVL-2418 GCGCCTCGAG CAGTGAAAGAACCTCTCCCA Xho I
  GCGCAAGCTT CCATCCGACACTTACCAGAC Hind III
pGL3-IVL-1809 GCGCCTCGAG ATGATCCAGGAACATGACAA Xho I
  GCGCAAGCTT CCATCCGACACTTACCAGAC Hind III
pGL3-IVL-744 GCGCCTCGAG TTCTTATGAGCATGGCATTC Xho I
  GCGCAAGCTT CCATCCGACACTTACCAGAC Hind III
pGL3-IVL-272 GCGCCTCGAG AGTTGAGCTACCAGAATCCT Xho I
  GCGCAAGCTT CCATCCGACACTTACCAGAC Hind III
  1. PCR products amplified using the indicated primers were digested by Xho I and Hind III and cloned into the luciferase reporter vector pGL3