Skip to main content

Table 1 Primers used for LAMP

From: Development and evaluation of a loop-mediated isothermal amplification assay for the rapid detection of porcine cytomegalovirus under field conditions

Primer Type Length Sequence
F3 Forward outer 18-nt 5’- TATCTGGTTCTGGCGGAC -3’
B3 Backward outer 23-nt 5’- AGCATATTTCTCTTTCTAGTCTC -3’
FIP Forward inner (F1c + F2) 46-mer(F1c:25-nt, F2:21-nt) 5’- TAGCAGATGCTTCCATATGGTAATT-GGGCAGATATTGTATACAGGA -3’
BIP Backward inner(B1c + B2) 43-mer (B1c:22-nt, B2:21-nt) 5’- TTCTAAGTTGGCCTACTTGCCC-ATGAAGGATACACGTGAACAC -3’
LF Loop Forward 23-nt 5’- ACAACTCCTTAACGATCACCGAA -3’
LB Loop Backward 25-nt 5’-ATCAGGAAGGTGATAAATGATGGAC -3’