Skip to main content

Advertisement

Table 1 Primer sets for PCV2a and PCV2b of LAMP method

From: Development of a loop-mediated isothermal amplification method to rapidly detect porcine circovirus genotypes 2a and 2b

Primers for PCV2a Primes for PCV2b
Primer name Sequence (5′ → 3′) Primer name Sequence (5′ → 3′)
FIPa AGGGCCAGAATTCAACCTTAACCTTTT GGGACCAACAAAATCTCT FIPb AGCAGGGCCAGAATTCAACCTTTTTT CTCAAACCCCCTCACTG
BIPa GGGCTCCACTGCTGTTATTTTT GGTCATAGGTTAGGGCTGT BIPb GGTGACAGGGGAGTGGGCTTTTT GGTCATAGGTGAGGGCTGT
F3a TTTAAAATTGACGACTTTGTTCC F3b ACTTTCTTCCCCCAGGAGG
B3a ATTGTATGGCGGGAGGAG B3b GGTATGGCGGGAGGAGTA